14 creating a gpo link to an ou
báo cáo hóa học:" Dimensions and correlates of quality of life according to frailty status: a cross-sectional study on community-dwelling older adults referred to an outpatient geriatric service in Italy" ppt
Ngày tải lên :
20/06/2014, 16:20
... QOL-related groups A P-value less than or equal to 0.05 was assumed to indicate statistical significance As far as multivariate analyses in the total sample were concerned, two models of linear regression ... estimated at more than 30% It was therefore calculated that with a sample of about 240 participants the study would have obtained an almost 80% statistical power at 5% alpha level to detect a difference ... Correlates of QOL according to frailty status In the total sample several variables, including frailty, were significantly associated with a worse QOL at univariate analyses (Table and Additional...
- 10
- 351
- 0
Báo cáo khoa học: "Major liver resection for hepatocellular carcinoma in the morbidly obese: A proposed strategy to improve outcome" doc
Ngày tải lên :
09/08/2014, 07:21
... hepatocellular carcinoma part of the natural history of nonalcoholic steatohepatitis? Gastroenterology 2002, 123:375-378 Shimada M, Hashimoto E, Taniai M, Hasegawa K, Okuda H, Hayashi N, Takasaki ... Lencioni R, Allgaier HP, Marchiano A, Fornari F, Quaretti P, Tolla GD, Ambrosi C, Mazzaferro V, et al.: Percutaneous radio-frequency thermal ablation of nonresectable hepatocellular carcinoma after ... Imamura H, Hasegawa K, Matsukura A, Sano K, Sugawara Y, Kokudo N, Makuuchi M: Sequential preoperative arterial and portal venous embolizations in patients with hepatocellular carcinoma Archives...
- 5
- 332
- 0
Báo cáo y học: "Tissue fibrocytes in patients with mild asthma: A possible link to thickness of reticular basement membrane" pptx
Ngày tải lên :
12/08/2014, 16:20
... in area A+ B were counted and correlated (r = 0.711) to thickness of basement membrane (µm) (E) Values are presented as means ± SEM Spearman coefficient of rank correlation was used to calculate ... months prior to the study All of the patients with asthma were atopic and sensitive to pets (cat allergy) Five of the patients with asthma had perennial allergy and one patient had seasonal allergy ... by airway epithelium and surrounding inflammatory cells may explain the observed difference in numbers of fibrocytes in area A compared to area B and C Factors that have previously been shown to...
- 9
- 314
- 0
Hướng dẫn bói bài Tarot Real tarot a modern approach to an ancient art
Ngày tải lên :
17/02/2016, 11:57
... are no fixed rules for Tarot, and there are no fixed meanings that you have to attribute to any card When you are doing a Tarot card reading and you gain information about a situation that you ... Sticks/Batons/Staves were changed to Wands, and the suit of Coins was changed to Pentacles Many of the Major Arcana cards have been renamed too Notable name changes over the years include The Beggar—changed ... windows to another world You are about to walk down this passageway and look into each of these portals As you this, you will learn about each card‘s nature and its characteristics At the first framed...
- 92
- 354
- 1
báo cáo khoa học: "Increasing delivery of an outdoor journey intervention to people with stroke: A feasibility study involving five community rehabilitation teams" pps
Ngày tải lên :
10/08/2014, 10:23
... Vincent’s and Mater Health Sydney and the Australian Catholic University, New South Wales, Australia 4National Centre for Clinical Outcomes Research (NaCCOR), Nursing and Midwifery, The Australian Catholic ... physiotherapists and occupational therapists, and involvement of therapy assistants Role sharing and expansion are examples of organisational interventions [35] A more in-depth examination of how therapists ... if the changes in team behaviour were due to the ‘Out-andAbout Implementation Program’ or factors related to the teams and health environment at the time Our next study, a cluster randomised...
- 10
- 295
- 0
Before designing, check out the party! Here’s how to transform a dull layout into an energetic expression of the real event.
Ngày tải lên :
01/03/2016, 22:19
... repeating measurements For example, you want the banjo big and at an angle, the type massive, the space full Note that to fit the space, the banjo has had to move around Here you can see that ... repeating measurements For example, you want the banjo big and at an angle, the type massive, the space full Note that to fit the space, the banjo has had to move around Here you can see that ... background and image in hand—the event is beginning to look real—it’s time to arrange the space for party energy To this, think mass, silhouette and angle After Angles convey energy Angles are...
- 18
- 336
- 0
Báo cáo y học: "A possible link between exercise-training adaptation and dehydroepiandrosterone sulfate- an oldest-old female study"
Ngày tải lên :
31/10/2012, 16:49
... conditions, ATP demands are immediately increased Carbohydrate fuel, as an anaerobic substrate, has the advantage of having a fast degradation rate and can occur in the absence of oxygen for rapid ATP ... on an ELISA analyzer (Tecan Genios, Salzburg, Austria) with the use of commercially available ELISA kits (Diagnostic Systems Laboratories, Inc Webster, Texas, USA), according to the manufacture’s ... according to the manufacturer’s procedures BP, HR, and arterial oxygen saturation BP and HR were measured quietly and at constant temperature (~ 23°C) Participants were provided with an automated oscillometric...
- 7
- 338
- 0
An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel
Ngày tải lên :
07/09/2013, 13:19
... notional and functional - and that we take a balanced, multidimensional approach to syllabus design 1.2.5 Essential steps in designing a language syllabus There are many approaches to syllabus ... learner, the skills-centered approach still approaches the learner as a user of language rather than as a learner of language 1.2.3.3 A learning centered approach According to Hutchinson and Water ... examine the nature and function of language in detail All of these, according to Ferguson (1972), agree on two points: language is an answer to a need to communication, and language forms are...
- 43
- 591
- 1
Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams
Ngày tải lên :
24/10/2013, 08:20
... team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and the requirements analysts and ... communication, clarity about project objectives, and support throughout the organization • Organizational strategy: At the top of the funnel is organizational strategy Organizational strategy is ... might take one’s bank balances as an input and act upon them to produce a pie chart, comparing these balances as an output OD practitioners compare “process” with “task,” where the “task” is what...
- 33
- 567
- 0
Tài liệu Converting a DataSet to an ADO Recordset docx
Ngày tải lên :
14/12/2013, 18:16
... ""; xmlDoc.LoadXml(adoXml); // Create a namespace manager for the XML document XmlNamespaceManager nm = new XmlNamespaceManager(xmlDoc.NameTable); // Add ADO prefixes nm.AddNamespace("s", "uuid:BDC6E3F0-6DA3-11d1 -A2 A3-00AA00C14882"); ... schema section and the data section The schema section is required and contains detailed metadata about each column in the table The data section contains an element for each row Column data is stored ... Load the ADO recordset into a DataTable OleDbDataAdapter oleDa = new OleDbDataAdapter( ); DataTable dt = new DataTable("Orders"); oleDa.Fill(dt, rs); // Bind the default view of the table to the...
- 15
- 390
- 0
Tài liệu Returning an Output Parameter Using a DataReader docx
Ngày tải lên :
14/12/2013, 18:16
... data value to the stored procedure and the stored procedure to pass a data value back to the caller Output The parameter is an output parameter allowing the stored procedure to pass a data value ... parameter is an input parameter allowing the caller to pass a data value to the stored procedure The parameter is both an input and output parameter, allowing the caller InputOutput to pass a ... result.ToString( ); Discussion Output parameters allow a stored procedure to pass a data value or cursor variable back to the caller To use an output parameter with a DataReader, add the output parameter...
- 4
- 266
- 0
a guide to building outdoor stairs
Ngày tải lên :
17/12/2013, 10:44
... posts to the location of the top and bottom rails The top surface of the upper rail should be 30" to 34" above the tread; the rail should be about 6" above the tread Lay the railing material against ... the posts and lay out angled cuts for any rails that will be fastened between the posts • Cut the railings to length and toenail them with four 8d galvanized nails If you'll be using balusters, ... hangers (Fig 6), or bolt them in place to a joist (Fig 7) If you need to pour a concrete landing pad at the bottom of the stairway, set the stringers in place temporarily and lay out the location...
- 5
- 313
- 0
Tài liệu Creating a Class That Participates in an Automatic Transaction ppt
Ngày tải lên :
24/12/2013, 05:15
... in an existing transaction, to start a new transaction, or to not participate in a transaction The following steps prepare a class to participate in an automatic transaction: Derive the class ... transactions that span multiple remote databases and multiple resource managers Objects participating in automatic transactions not need to anticipate how they might be used within a transaction ... automatic transaction Once an object is marked to participate in a transaction, it will automatically execute within a transaction The object's transactional behavior is controlled by the value...
- 5
- 410
- 0
Tài liệu Cấp giấy phép thầu cho nhà thầu nước ngoài là tổ chức nhận thầu các gói thầu thuộc dự án nhóm A và các dự án đầu tư thuộc địa bàn 2 tỉnh trở lên doc
Ngày tải lên :
24/01/2014, 19:20
... công trình xây dựng Tài liệu đính kèm viết Mau don xin phep thau T1TW.doc(Mau don xin phep thau T1TW_1249971538514.doc) Tải Mau bao cao T1TW.doc(Mau bao cao T1TW_1249971538274.doc) Tải ... kiện 3: Trong trường hợp giao thầu (do thắng thầu thông qua đấu thầu chọn thầu) nhà thầu nước phải liên danh với nhà thầu Việt Nam phải sử dụng nhà thầu phụ Việt Nam (trừ trường hợp Thủ tướng ... phép theo quy định pháp luật Việt Nam) d) Yêu cầu điều kiện 4: Phải cam kết thực đầy đủ quy định pháp luật Việt Nam có liên quan đến hoạt động nhận thầu Việt Nam 1.11 Căn pháp lý thủ tục hành...
- 3
- 341
- 0
Tài liệu Exporting the Results of a Query to an Array pdf
Ngày tải lên :
26/01/2014, 10:20
... (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection ... the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the names ... = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected...
- 5
- 309
- 0
How to get out of the friendzone: turn your friendship into a relationship
Ngày tải lên :
10/02/2014, 18:17
... Sam ran into Katie, who threw her arms around him and whispered that they needed to talk; she’d heard he was dating someone and wanted to know all about it After hearing about Cara, Katie badmouthed ... Your buddies all think you guys are in love and tease you about how you’re already married to your friend, and that’s why you never have a date You always shrug them off and tell them that you ... met Cara at his coed dodgeball tournament She was pretty and nice and seemed to like him back They started dating and things were going well At a party soon after Sam and Cara started seeing each...
- 240
- 1.1K
- 1
Tài liệu Business Process Outsourcing Accenture Finance and Accounting BPO Services Creating a high-performance finance organization pptx
Ngày tải lên :
17/02/2014, 09:20
... Management & Billing Manage and Process Collections Maintain Customer Master Data Manage Sales Orders Manage and Process Disputes & Deductions Maintain A/ R Ledger and Apply Cash Manage Contracts ... comprehensive and collaborative task management tool that effectively and collaboratively manages the monthly close, enabling management and process owners to capture and track critical path activities and ... Asset & Transactional Processing Help Desk Period Close & Data Integrity Intercompany Accounting Fixed Assets Accounting Master Data Maintenance Account Reconciliation and Analysis Transaction Processing...
- 16
- 606
- 1
Tài liệu Adding value to traditional products of regional origin - A guide to creating a quality consortium pptx
Ngày tải lên :
18/02/2014, 21:20
... consortia are managed through an assembly of delegates, where all links in the production chain are represented, and a board of directors, normally consisting of a chairman, a secretary and various ... cigars manufactured by the company are marketed under various international, regional, local and niche trademarks, but all carry the “Habanos” label This name has been registered as a geographical ... name only obtains protection, in the best-case scenario, as a trademark Meanwhile, in countries such as Thailand, Malaysia or Indonesia, for example, handicraft and industrial products can aspire...
- 79
- 438
- 0
A Special Addition to Staying Healthy: An English Learner’s Guide to Health Care and Healthy Living ppt
Ngày tải lên :
05/03/2014, 13:20
... normal Benign tumors not contain cancer, and they not spread (Benign means “not dangerous.”) Malignant tumors are cancer They can kill you It is very important to treat malignant tumors as soon as ... feeling your breasts If you notice any changes in your breasts, see your health care provider right away He or she may send you to get a mammogram What is a Mammogram? A mammogram is an X-ray or picture ... help you understand your body and your doctor’s visits Talk to your doctor about any specific concerns or worries Wo m e n’s Healt h - Pa r t I : Hea l thy at All Ages Major Changes in a Woman’s...
- 37
- 546
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
Ngày tải lên :
07/03/2014, 09:20
... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... used to amplify omcA (lane 2), omcB (lane 3), mtrA (lane 4) and mtrB (lane 5) in the omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT...
- 11
- 731
- 0